Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6m-WPRE-pA
(Plasmid #51473)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51473 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Due to ease of recombination, AAV and lentivirus vectors should be amplified in a recombination deficient bacteria strain such as Invitrogen's OneShot Stbl3 cells. Check for integrety of ITR sites with SmaI digest.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mRuby2-P2A-GCaMP6m
  • Species
    R. norvegicus (rat), G. gallus (chicken); ; A. victoria (jellyfish)
  • Insert Size (bp)
    2124
  • Promoter hSyn1

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer actcagcgctgcctcagtct
  • 3′ sequencing primer gtttgtacaaatgatgacagcgaag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mRuby2: Article: Improving FRET dynamic range with bright green and red fluorescent proteins. Lam et al (Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. PubMed) Addgene Plasmid 40260 GCaMP6s: Article: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354. PubMed) Addgene Plasmid 40754
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The discrepancies between the full sequence and Addgene's QC sequence should not have any functional consequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6m-WPRE-pA was a gift from Tobias Bonhoeffer & Mark Huebener & Tobias Rose (Addgene plasmid # 51473 ; http://n2t.net/addgene:51473 ; RRID:Addgene_51473)
  • For your References section:

    Cell-specific restoration of stimulus preference after monocular deprivation in the visual cortex. Rose T, Jaepel J, Hubener M, Bonhoeffer T. Science. 2016 Jun 10;352(6291):1319-22. doi: 10.1126/science.aad3358. 10.1126/science.aad3358 PubMed 27284193