pAP24
(Plasmid
#70190)
-
PurposeModular vector for secreted luciferase reporter expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRPF185
-
Backbone manufacturerFagan and Fairweather 2009
- Backbone size w/o insert (bp) 7216
- Total vector size (bp) 7913
-
Modifications to backboneReplaced gusA from original pRPF185 with amyEopt
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor E.coli, use Cm at 20ug/mL for growth on solid media, but 10ug/mL for growth in liquid medium. For C. difficile use thiamphenicol at 15ug/mL.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesLucopt
-
Alt namesecreted codon-optimized Nanoluc
-
SpeciesSynthetic
-
Insert Size (bp)597
- Promoter Ptet
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer NF_1323 (CTGGACTTCATGAAAAACTAAAAAAAATATTG)
- 3′ sequencing primer NF_794 (CACCGACGAGCAAGGCAAGACCG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Publication describing the backbone vector pRPF185 as well as the sequencing primers:
Clostridium difficile has two parallel and essential Sec secretion systems. Fagan RP, Fairweather NF. J Biol Chem. 2011 Aug 5;286(31):27483-93. doi: 10.1074/jbc.M111.263889. Epub 2011 Jun 9.
PMID: 21659510
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAP24 was a gift from Wiep Klaas Smits (Addgene plasmid # 70190 ; http://n2t.net/addgene:70190 ; RRID:Addgene_70190) -
For your References section:
The Signal Sequence of the Abundant Extracellular Metalloprotease PPEP-1 Can Be Used to Secrete Synthetic Reporter Proteins in Clostridium difficile. Oliveira Paiva AM, Friggen AH, Hossein-Javaheri S, Smits WK. ACS Synth Biol. 2016 Jun 23. 10.1021/acssynbio.6b00104 PubMed 27333161