pAP84
(Plasmid
#86554)
-
PurposeExpresses sLucopt luciferase from the constitive Bacillus subtilis promoter Pveg in Clostridium difficile
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRPF185
-
Backbone manufacturerRobert Fagan and Neil Fairweather
- Backbone size w/o insert (bp) 6378
- Total vector size (bp) 7072
-
Modifications to backboneCut KnpI, BamHI to remove Ptet-gusA; insertion of Pveg-sLucopt
-
Vector typeBacterial Expression, Luciferase, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsOccasional insertions of an IS element commonly found in E.coli cloning strains is observed; the Pveg promoter seems particularly prone to insertions. If problems are encountered, we recommend maintaining the plasmid in, and isolating it from, strains that are negative for this element. By PCR, MC1061 or derivative strains are negative. DH5a or derivatives should be avoided. IS-less cloning strains (such as MDS42) are recommended. Growth on 20ug/mL Cm on plate (E.coli), or 10 ug/mL Cm in liquid culture (E.coli). For C. difficile selection use Thiamphenicol at 15 ug/mL.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePveg-sLucopt
-
Alt namesecreted luciferase expressed from constitutive promoter
-
SpeciesSynthetic; Bacillus subtilis
-
Insert Size (bp)694
-
GenBank IDNC_000964
- Promoter Pveg
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer NF_793 (CACCTCCTTTTTGACTTTAAGCCTACGAATACC)
- 3′ sequencing primer NF_794 (CACCGACGAGCAAGGCAAGACCG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the individual components of this construct (that is, Pveg and sLucopt) are described in Oliveira Paiva AM et al (2016) ACS Synth Biol (DOI: 10.1021/acssynbio.6b00104). During the cloning a mutation occurred that removes the SacI site in between the Pveg and sLucopt genes. The 5' (KpnI) and 3' (BamHI) restriction sites remain.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAP84 was a gift from Wiep Klaas Smits (Addgene plasmid # 86554 ; http://n2t.net/addgene:86554 ; RRID:Addgene_86554)