lentiCas9-Venus
(Plasmid #70267)

• Purpose: Expresses human codon-optimized S. pyogenes Cas9 protein and Venus reporter from EFS promoter. Lentiviral backbone.
• Depositing Lab: Daniel Bauer
• Publication: Canver et al Nature. 2015 Sep 16. doi: 10.1038/nature15521.

Backbone

• Vector backbone: pFUGW
• Backbone size w/o insert (bp): 9080
• Total vector size (bp): 13181
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Venus

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Only amplify in RecA- bacteria (eg. Stbl3).
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cas9
• Alt name: S. pyogenes CRISPR-Cas9
• Species: Synthetic
• Insert Size (bp): 4101
• Promoter: EFS-NS
• Tag / Fusion Protein:
  • FLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI, XbaI, AfeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TTCTGCAGACAAATGGCAGT
• 3′ sequencing primer: GCTGAACTTGTGGCCGTTTA

Gene/Insert 2

• Gene/Insert name: Venus Reporter
• Species: Synthetic
• Insert Size (bp): 720
• Promoter: P2A

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TACGAGACACGGATCGACCT
• 3′ sequencing primer: AAGCCATACGGGAAGCAATA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Subcloned Venus in place of Blast in lentiCas9-Blast.
Improved vectors and genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. 10.1038/nmeth.3047 PubMed 25075903

Canver MC, Smith EC, Sher F, Pinello L, Sanjana NE, Shalem O, Chen DD, Schupp PG, Vinjamur DS, Garcia SP, Luc S, Kurita R, Nakamura Y, Fujiwara Y, Maeda T, Yuan G, Zhang F, Orkin SH, Bauer DE. BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis. Nature. 2015 September 16; in press; doi:10.1038/nature15521.