-
PurposeInducible shRNA knockdown of both human DDX5 and DDX17 genes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71307 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRIPZ
-
Backbone manufacturerGE - Dharmacon
- Backbone size w/o insert (bp) 13362
- Total vector size (bp) 13406
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin, Zeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDDX5/17 shRNA
-
gRNA/shRNA sequenceAGGGCTAGATGTGGAAGATGT
-
SpeciesH. sapiens (human)
-
GenBank IDNM_004396 NM_001098504, NM_006386
-
Entrez GeneDDX17 (a.k.a. P72, RH70)
- Promoter TetO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer 5’-GGAAAGAATCAAGGAGG-3’
- 3′ sequencing primer 5'-TCTGACGTGGCAGCGCTCGCC-3' (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIPZ-hDDX5/17 was a gift from Allan Brasier (Addgene plasmid # 71307 ; http://n2t.net/addgene:71307 ; RRID:Addgene_71307) -
For your References section:
Systematic Determination of Human Cyclin Dependent Kinase (CDK)-9 Interactome Identifies Novel Functions in RNA Splicing Mediated by the DEAD Box (DDX)-5/17 RNA Helicases. Yang J, Zhao Y, Kalita M, Li X, Jamaluddin M, Tian B, Edeh CB, Wiktorowicz JE, Kudlicki A, Brasier AR. Mol Cell Proteomics. 2015 Oct;14(10):2701-21. doi: 10.1074/mcp.M115.049221. Epub 2015 Jul 24. 10.1074/mcp.M115.049221 PubMed 26209609