Skip to main content

pFUGW-FerH-ffLuc2-eGFP
(Plasmid #71393)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71393 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFUGW
  • Backbone size w/o insert (bp) 5828
  • Total vector size (bp) 9741
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    None

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FerH-ffLuc2-eGFP
  • Alt name
    SV40 enhancer-human ferritin minimal promoter- firefly luciferase-eGFP fusion gene
  • Species
    M. musculus (mouse); firefly and jellyfish
  • Insert Size (bp)
    3913
  • Promoter FerH

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATCCATTCGATTAGTGAACGG
  • 3′ sequencing primer GCCATACGGGAAGCAATAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    eGFP gene was synthetically produced. FerH promoter was amplified from a plasmid from Invivogen
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUGW-FerH-ffLuc2-eGFP was a gift from Glenn Merlino (Addgene plasmid # 71393 ; http://n2t.net/addgene:71393 ; RRID:Addgene_71393)
  • For your References section:

    Lentivirus-mediated bifunctional cell labeling for in vivo melanoma study. Day CP, Carter J, Bonomi C, Esposito D, Crise B, Ortiz-Conde B, Hollingshead M, Merlino G. Pigment Cell Melanoma Res. 2009 Jun;22(3):283-95. doi: 10.1111/j.1755-148X.2009.00545.x. Epub 2009 Jan 19. 10.1111/j.1755-148X.2009.00545.x PubMed 19175523