Skip to main content
Addgene

pAAV-flex-rev-g2-2A-Venus
(Plasmid #71410)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71410 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 7748
  • Vector type
    Mammalian Expression, AAV, Cre/Lox
  • Promoter mouse hdc gene promoter, works as a pan neuronal promoter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer ACGCTGAACTTGTGGCCGTTTA
  • 3′ sequencing primer TTTTGCTTGTTCAATCTTGTTTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was constructed from two others: pAAV-CAG-promoter-Cre-2A-gamma22F77, kindly provided by Zoltan Nusser, Institute of Experimental Medicine, Hungarian Academy of Sciences, Budapest, Hungary (Sumegi M., et al., 2012, J Physiol 590: 1517); and pAAV-flex-rev-hM4-mCherry (Addgene plasmid 44362, gift of Bryan Roth, University of North Carolina at Chapel Hill, USA; (Krashes MJ et al., 2011, J Clin Invest 121: 1424). The promoter fragment from the mouse hdc gene is unpublished, but we found it works as a panneuronal promoter, although it was intended to be selective for histaminergic neurons.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid allows the introduction of zolpidem sensitivity into non-zolpidem senstive neurons. It has to be used in conjuction with the mouse line gabrg2I77lox (deposited in JAX labs, stock number, https://www.jax.org/strain/021197 (Gabrg2tm1Wul).

This plasmid was constructed from two others: pAAV-CAG-promoter-Cre-2A-gamma22F77, kindly provided by Zoltan Nusser, Institute of Experimental Medicine, Hungarian Academy of Sciences, Budapest, Hungary (Sumegi M., et al., 2012, J Physiol 590: 1517); and pAAV-flex-rev-hM4-mCherry (Addgene plasmid 44362, gift of Bryan Roth, University of North Carolina at Chapel Hill, USA; (Krashes MJ et al., 2011, J Clin Invest 121: 1424). The promoter fragment from the mouse hdc gene is unpublished, but we found it works as a panneuronal promoter, although it was intended to be selective for histaminergic neurons.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-flex-rev-g2-2A-Venus was a gift from William Wisden (Addgene plasmid # 71410 ; http://n2t.net/addgene:71410 ; RRID:Addgene_71410)
  • For your References section:

    Bottom-Up versus Top-Down Induction of Sleep by Zolpidem Acting on Histaminergic and Neocortex Neurons. Uygun DS, Ye Z, Zecharia AY, Harding EC, Yu X, Yustos R, Vyssotski AL, Brickley SG, Franks NP, Wisden W. J Neurosci. 2016 Nov 2;36(44):11171-11184. 10.1523/JNEUROSCI.3714-15.2016 PubMed 27807161