pC001 - huLshC2C2-MBP for bacterial expression
(Plasmid #79150)

• Purpose: Expresses human codon-optimized LshC2c2 for purification in E. coli
• Depositing Lab: Feng Zhang
• Publication: Abudayyeh et al Science. 2016 Jun 2. pii: aaf5573.

Backbone

• Vector backbone: BPV00356 pET21GG2-His(6)-MBP_Flag-Avi
• Backbone manufacturer: Zhang lab
• Backbone size w/o insert (bp): 6650
• Total vector size (bp): 10955
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: C2c2
• Alt name: Cas13a
• Species: Leptotrichia shahii
• Insert Size (bp): 4305
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (unknown if destroyed)
• 3′ cloning site: BsaI (unknown if destroyed)
• 5′ sequencing primer: atggggaacctgttcggacaca

Resource Information

• Supplemental Documents:
  • pC001 genbank file
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry