Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pC001 - huLshC2C2-MBP for bacterial expression
(Plasmid #79150)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79150 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    BPV00356 pET21GG2-His(6)-MBP_Flag-Avi
  • Backbone manufacturer
    Zhang lab
  • Backbone size w/o insert (bp) 6650
  • Total vector size (bp) 10955
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    C2c2
  • Alt name
    Cas13a
  • Species
    Leptotrichia shahii
  • Insert Size (bp)
    4305
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (unknown if destroyed)
  • 3′ cloning site BsaI (unknown if destroyed)
  • 5′ sequencing primer atggggaacctgttcggacaca
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC001 - huLshC2C2-MBP for bacterial expression was a gift from Feng Zhang (Addgene plasmid # 79150 ; http://n2t.net/addgene:79150 ; RRID:Addgene_79150)
  • For your References section:

    C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Abudayyeh OO, Gootenberg JS, Konermann S, Joung J, Slaymaker IM, Cox DB, Shmakov S, Makarova KS, Semenova E, Minakhin L, Severinov K, Regev A, Lander ES, Koonin EV, Zhang F. Science. 2016 Jun 2. pii: aaf5573. 10.1126/science.aaf5573 PubMed 27256883