-
PurposeExpresses human codon-optimized LshC2c2 for purification in E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79150 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBPV00356 pET21GG2-His(6)-MBP_Flag-Avi
-
Backbone manufacturerZhang lab
- Backbone size w/o insert (bp) 6650
- Total vector size (bp) 10955
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameC2c2
-
Alt nameCas13a
-
SpeciesLeptotrichia shahii
-
Insert Size (bp)4305
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (unknown if destroyed)
- 3′ cloning site BsaI (unknown if destroyed)
- 5′ sequencing primer atggggaacctgttcggacaca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC001 - huLshC2C2-MBP for bacterial expression was a gift from Feng Zhang (Addgene plasmid # 79150 ; http://n2t.net/addgene:79150 ; RRID:Addgene_79150) -
For your References section:
C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Abudayyeh OO, Gootenberg JS, Konermann S, Joung J, Slaymaker IM, Cox DB, Shmakov S, Makarova KS, Semenova E, Minakhin L, Severinov K, Regev A, Lander ES, Koonin EV, Zhang F. Science. 2016 Jun 2. pii: aaf5573. 10.1126/science.aaf5573 PubMed 27256883