Skip to main content

pMIR-FLAG-MLL-AF9
(Plasmid #71444)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71444 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMIRL
  • Backbone size w/o insert (bp) 6600
  • Total vector size (bp) 11100
  • Modifications to backbone
    Replaced GFP of pMIG with DsRed Express2
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MLL-AF9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4500
  • Entrez Gene
    KMT2A (a.k.a. ALL-1, ALL1, CXXC7, GAS7, HRX, HTRX, HTRX1, MLL, MLL1, MLL1A, TRX1, WDSTS)
  • Promoter MSCV
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer cccttgaacctcctcgttcgacc
  • 3′ sequencing primer CCAAAAGACGGCAATATGGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Jay Hess (University of Michigan)
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMIR-FLAG-MLL-AF9 was a gift from Daisuke Nakada (Addgene plasmid # 71444 ; http://n2t.net/addgene:71444 ; RRID:Addgene_71444)
  • For your References section:

    AMPK Protects Leukemia-Initiating Cells in Myeloid Leukemias from Metabolic Stress in the Bone Marrow. Saito Y, Chapple RH, Lin A, Kitano A, Nakada D. Cell Stem Cell. 2015 Sep 29. pii: S1934-5909(15)00374-4. doi: 10.1016/j.stem.2015.08.019. 10.1016/j.stem.2015.08.019 PubMed 26440282