pDZ529 pTRP MET25p PP7-PS-2x-yeGFP
              
              
                (Plasmid
                
                #72233)
              
            
            
            
          - 
            PurposeTryptophan selection; Expression of PP7-2x-yeGFP fusion protein under the MET25 promoter
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72233 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepTRP
- Backbone size w/o insert (bp) 5529
- Total vector size (bp) 7362
- 
              Vector typeYeast Expression
- 
                Selectable markersTRP1
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert namePP7-PS-2x-yeGFP
- 
                    SpeciesSynthetic
- 
                  Insert Size (bp)1833
- Promoter MET25
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GTTTACAATACAACGATAGCG
- 3′ sequencing primer TTAGAGCGGATGTGGG (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pDZ529 pTRP MET25p PP7-PS-2x-yeGFP was a gift from Daniel Zenklusen (Addgene plasmid # 72233 ; http://n2t.net/addgene:72233 ; RRID:Addgene_72233)
- 
                For your References section: The nuclear basket mediates perinuclear mRNA scanning in budding yeast. Saroufim MA, Bensidoun P, Raymond P, Rahman S, Krause MR, Oeffinger M, Zenklusen D. J Cell Biol. 2015 Dec 21;211(6):1131-40. doi: 10.1083/jcb.201503070. 10.1083/jcb.201503070 PubMed 26694838
 
    
 
                         
             
            