Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDZ529 pTRP MET25p PP7-PS-2x-yeGFP
(Plasmid #72233)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72233 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTRP
  • Backbone size w/o insert (bp) 5529
  • Total vector size (bp) 7362
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PP7-PS-2x-yeGFP
  • Species
    Synthetic
  • Insert Size (bp)
    1833
  • Promoter MET25

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GTTTACAATACAACGATAGCG
  • 3′ sequencing primer TTAGAGCGGATGTGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDZ529 pTRP MET25p PP7-PS-2x-yeGFP was a gift from Daniel Zenklusen (Addgene plasmid # 72233 ; http://n2t.net/addgene:72233 ; RRID:Addgene_72233)
  • For your References section:

    The nuclear basket mediates perinuclear mRNA scanning in budding yeast. Saroufim MA, Bensidoun P, Raymond P, Rahman S, Krause MR, Oeffinger M, Zenklusen D. J Cell Biol. 2015 Dec 21;211(6):1131-40. doi: 10.1083/jcb.201503070. 10.1083/jcb.201503070 PubMed 26694838