-
PurposeExpress mCherry and puromycin resistance gene under CMV promoter. 3rd gen lentiviral vector.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72264 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH-CMV-MCS
-
Backbone manufacturerSystembio
- Backbone size w/o insert (bp) 6227
-
Modifications to backboneClaI/Sal fragment was replace with CMV promoter + new MCS
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-T2A-Puro
-
Insert Size (bp)1386
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCACCAAAATCAACGGGAC
- 3′ sequencing primer CAACACCACGGAATTGTCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-CMV-mCherry-T2A-Puro was a gift from Kazuhiro Oka (Addgene plasmid # 72264 ; http://n2t.net/addgene:72264 ; RRID:Addgene_72264)