-
PurposeCombines a gCaMP-based calcium indicator and an Arch-based voltage indicator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72304 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFCK
-
Backbone manufacturerPavel Osten
- Backbone size w/o insert (bp) 9235
- Total vector size (bp) 11528
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCaViar
-
Alt nameQuasAr2 + GCaMP6f
-
SpeciesSynthetic
-
Insert Size (bp)3907
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- TS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcctctttgccccacttaat
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJMK077: CaMKIIa QuasAr2-TS-GCaMP6f was a gift from Adam Cohen (Addgene plasmid # 72304 ; http://n2t.net/addgene:72304 ; RRID:Addgene_72304) -
For your References section:
Cardiotoxicity screening with simultaneous optogenetic pacing, voltage imaging and calcium imaging. Dempsey GT, Chaudhary KW, Atwater N, Nguyen C, Brown BS, McNeish JD, Cohen AE, Kralj JM. J Pharmacol Toxicol Methods. 2016 May 13. pii: S1056-8719(16)30044-2. doi: 10.1016/j.vascn.2016.05.003. 10.1016/j.vascn.2016.05.003 PubMed 27184445