- 
            PurposeExpression of cytosolic APEX2 in bacteria
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72558 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepTRC
- Backbone size w/o insert (bp) 2282
- Total vector size (bp) 1509
- 
              Vector typeBacterial Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
              Growth instructionsFor expression and purification from bacterial cells, it is recommended to supplement cultures with 1 mM 5-aminolevulinic acid after induction with IPTG, with subsequent growth at room temperature to promote higher heme incorporation.
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameAPEX2
- 
                    SpeciesSoybean
- 
                  MutationA134P relative to APEX
- 
    
        Tag
        / Fusion Protein
    - His6 (N terminal on insert)
 
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGCTGTTGACAATTAATCATCC (Common Sequencing Primers)
Resource Information
- 
            Articles Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pTRC-APEX2 was a gift from Alice Ting (Addgene plasmid # 72558 ; http://n2t.net/addgene:72558 ; RRID:Addgene_72558)
- 
                For your References section: Directed evolution of APEX2 for electron microscopy and proximity labeling. Lam SS, Martell JD, Kamer KJ, Deerinck TJ, Ellisman MH, Mootha VK, Ting AY. Nat Methods. 2014 Nov 24. doi: 10.1038/nmeth.3179. 10.1038/nmeth.3179 PubMed 25419960
