pSAM2_mCherry_Nkx2.5
(Plasmid
#72689)
-
PurposeDoxycyline regulated expression of Nkx2.5 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSAM2_GW_mCherry
- Backbone size w/o insert (bp) 11391
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNkx 2.5
-
SpeciesM. musculus (mouse)
-
Entrez GeneNkx2-5 (a.k.a. Csx, Nkx-2.5, Nkx2.5, tinman)
- Promoter CMV-Doxycycline
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer pSAM 2 SEQ F - 5' GCTCGTTTAGTGAACCGTCAG 3'
- 3′ sequencing primer pSAM2 SEQ R - 5' GAGGAACTGCTTCCTTCACG 3'
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSAM2_mCherry_Nkx2.5 was a gift from Timothy Kamp (Addgene plasmid # 72689 ; http://n2t.net/addgene:72689 ; RRID:Addgene_72689) -
For your References section:
Lineage Reprogramming of Fibroblasts into Proliferative Induced Cardiac Progenitor Cells by Defined Factors. Lalit PA, Salick MR, Nelson DO, Squirrell JM, Shafer CM, Patel NG, Saeed I, Schmuck EG, Markandeya YS, Wong R, Lea MR, Eliceiri KW, Hacker TA, Crone WC, Kyba M, Garry DJ, Stewart R, Thomson JA, Downs KM, Lyons GE, Kamp TJ. Cell Stem Cell. 2016 Mar 3;18(3):354-67. doi: 10.1016/j.stem.2015.12.001. Epub 2016 Feb 11. 10.1016/j.stem.2015.12.001 PubMed 26877223