-
PurposeLarge fragment of split HRP fused to the extracellular terminus of neurexin3B. CAG promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73143 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4247
- Total vector size (bp) 6281
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesHRPa-NRX
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2034
- Promoter CAG
-
Tags
/ Fusion Proteins
- Flag
- 2x HA tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gctaaccatgttcatgccttc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sHRPa is the large split HRP fragment. It consists of amino acids 1-213 of horseradish peroxidase (HRP) with the following 4 mutations: T21I, P78S, R93G, N175S.
The insert contains the following features:
EcoRI- NRX3Beta ss-AgeI-sHRPa-5 aa linker-flag-MfeI-NRX(36-330 aa)-2x HA-NRX(331-429 aa)-stop-HindIII
5 aa linker: GSGSG
HA: YPYDVPDYA
NRX: human neurexin3β with 2 HA tags inserted internally, derived from a construct from Thomas Südhof (Gokce and Südhof, J. Neurosci., 33, 14617-14628, 2013).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG sHRPa-NRX was a gift from Alice Ting (Addgene plasmid # 73143 ; http://n2t.net/addgene:73143 ; RRID:Addgene_73143) -
For your References section:
A split horseradish peroxidase for the detection of intercellular protein-protein interactions and sensitive visualization of synapses. Martell JD, Yamagata M, Deerinck TJ, Phan S, Kwa CG, Ellisman MH, Sanes JR, Ting AY. Nat Biotechnol. 2016 May 30. doi: 10.1038/nbt.3563. 10.1038/nbt.3563 PubMed 27240195