Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

CAG sHRPb-FKBP-post mGRASP
(Plasmid #73146)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73146 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 4247
  • Total vector size (bp) 5731
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sHRPb-FKBP-post mGRASP
  • Species
    Synthetic
  • Insert Size (bp)
    1470
  • Promoter CAG
  • Tag / Fusion Protein
    • HA tag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site MfeI (not destroyed)
  • 5′ sequencing primer gctaaccatgttcatgccttc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

sHRPb is the small split HRP fragment. It consists of amino acids 214-308 of horseradish peroxidase (HRP) with the following 2 mutations: N255D, L299R

The insert contains the following features:
EcoRI-NLG1 ss-AgeI-sHRPb-10 aa linker-XhoI-FKBP12-HA epitope tag-MfeI-NLG1(630-843 aa)-stop-BglII-NotI

CAG promoter
10 aa linker: KGSGSTSGSG
HA epitope tag: YPYDVPDYA
FKBP12: We used a 107 aa sequence that is identical to chain A in PDB 2FAP.

This construct is identical to the previously reported “post-mGRASP” (Addgene ID 34912) except that 5 aa linker, HA tag, AgeI, and MfeI are added here, and residues 630-843 of NLG1 are used here instead of residues 627-843.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG sHRPb-FKBP-post mGRASP was a gift from Alice Ting (Addgene plasmid # 73146 ; http://n2t.net/addgene:73146 ; RRID:Addgene_73146)
  • For your References section:

    A split horseradish peroxidase for the detection of intercellular protein-protein interactions and sensitive visualization of synapses. Martell JD, Yamagata M, Deerinck TJ, Phan S, Kwa CG, Ellisman MH, Sanes JR, Ting AY. Nat Biotechnol. 2016 May 30. doi: 10.1038/nbt.3563. 10.1038/nbt.3563 PubMed 27240195