Skip to main content
Addgene

pcDNA3.1-kappa-HA-dL5-BKa
(Plasmid #73212)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73212 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 5626
  • Total vector size (bp) 9889
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BKalpha
  • Alt name
    Slo1
  • Alt name
    MaxiK
  • Alt name
    BKalpha
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4263
  • Entrez Gene
    Kcnma1 (a.k.a. 5730414M22Rik, BKCA alpha, BKCa, KCa1.1, MaxiK, Slo, Slo1, k(VCA)alpha, mSlo, mSlo1, slo-alpha)
  • Promoter CMV
  • Tag / Fusion Protein
    • dL5** (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site MfeI (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    BKalpha gene was received from Sonal Shruti & Alison Barth; gene was originally synthesized. Carnegie Mellon University
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

MfeI site was destroyed in cloning, but 3' ClaI site is useable for further subcloning.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-kappa-HA-dL5-BKa was a gift from Marcel Bruchez (Addgene plasmid # 73212 ; http://n2t.net/addgene:73212 ; RRID:Addgene_73212)
  • For your References section:

    Fluorogenic Green-Inside Red-Outside (GIRO) Labeling Approach Reveals Adenylyl Cyclase-Dependent Control of BKalpha Surface Expression. Pratt CP, He J, Wang Y, Barth AL, Bruchez MP. Bioconjug Chem. 2015 Sep 16;26(9):1963-71. doi: 10.1021/acs.bioconjchem.5b00409. Epub 2015 Sep 2. 10.1021/acs.bioconjchem.5b00409 PubMed 26301573

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More