pcDNA3.1-kappa-HA-dL5-BKa
(Plasmid
#73212)
-
PurposeExpresses HA-dL5(E52D)-BKa (KCNMA1, mSlo alpha subunit) in mammalian cells, with an Igk-leader. (MBIC5, dL5**, FAP)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73212 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5626
- Total vector size (bp) 9889
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBKalpha
-
Alt nameSlo1
-
Alt nameMaxiK
-
Alt nameBKalpha
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4263
-
Entrez GeneKcnma1 (a.k.a. 5730414M22Rik, BKCA alpha, BKCa, KCa1.1, MaxiK, Slo, Slo1, k(VCA)alpha, mSlo, mSlo1, slo-alpha)
- Promoter CMV
-
Tag
/ Fusion Protein
- dL5** (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site MfeI (destroyed during cloning)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBKalpha gene was received from Sonal Shruti & Alison Barth; gene was originally synthesized. Carnegie Mellon University
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
MfeI site was destroyed in cloning, but 3' ClaI site is useable for further subcloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-kappa-HA-dL5-BKa was a gift from Marcel Bruchez (Addgene plasmid # 73212 ; http://n2t.net/addgene:73212 ; RRID:Addgene_73212) -
For your References section:
Fluorogenic Green-Inside Red-Outside (GIRO) Labeling Approach Reveals Adenylyl Cyclase-Dependent Control of BKalpha Surface Expression. Pratt CP, He J, Wang Y, Barth AL, Bruchez MP. Bioconjug Chem. 2015 Sep 16;26(9):1963-71. doi: 10.1021/acs.bioconjchem.5b00409. Epub 2015 Sep 2. 10.1021/acs.bioconjchem.5b00409 PubMed 26301573