Skip to main content

pMD19T-psba1-TetR-PL22-dCas9-SpR
(Plasmid #73223)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73223 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMD19T simple
  • Backbone manufacturer
    Takara
  • Total vector size (bp) 10674
  • Modifications to backbone
    Has 2 psba1 homology regions flanking insert
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    We propogated this plasmid in E. coli Copy Cutter cells. We noticed mutations in TetR when using XL1-blue.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9 from S. pyogenes
  • Species
    S. pyogenes
  • Insert Size (bp)
    4137
  • Mutation
    Silent mutation at bp 1341 A->C to remove an EcoRI site
  • Promoter PL22
  • Tag / Fusion Protein
    • c-myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (destroyed during cloning)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer TCAGTGATAGAGATTGACATCCCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMD19T-psba1-TetR-PL22-dCas9-SpR was a gift from Paul Hudson (Addgene plasmid # 73223 ; http://n2t.net/addgene:73223 ; RRID:Addgene_73223)
  • For your References section:

    Multiple Gene Repression in Cyanobacteria Using CRISPRi. Yao L, Cengic I, Anfelt J, Hudson EP. ACS Synth Biol. 2015 Dec 28. 10.1021/acssynbio.5b00264 PubMed 26689101