pMD19T-psba1-TetR-PL22-dCas9-SpR
(Plasmid #73223)

• Purpose: Contains dCas9 from S. pyogenes under aTc inducible promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.
• Depositing Lab: Paul Hudson
• Publication: Yao et al ACS Synth Biol. 2015 Dec 28.

Backbone

• Vector backbone: pMD19T simple
• Backbone manufacturer: Takara
• Total vector size (bp): 10674
• Modifications to backbone: Has 2 psba1 homology regions flanking insert
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: We propogated this plasmid in E. coli Copy Cutter cells. We noticed mutations in TetR when using XL1-blue.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9 from S. pyogenes
• Species: S. pyogenes
• Insert Size (bp): 4137
• Mutation: Silent mutation at bp 1341 A->C to remove an EcoRI site
• Promoter: PL22
• Tag / Fusion Protein:
  • c-myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (destroyed during cloning)
• 3′ cloning site: SpeI (destroyed during cloning)
• 5′ sequencing primer: TCAGTGATAGAGATTGACATCCCT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry