pMD19T-psba1-TetR-PL22-dCas9-SpR
(Plasmid
#73223)
-
PurposeContains dCas9 from S. pyogenes under aTc inducible promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73223 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMD19T simple
-
Backbone manufacturerTakara
- Total vector size (bp) 10674
-
Modifications to backboneHas 2 psba1 homology regions flanking insert
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsWe propogated this plasmid in E. coli Copy Cutter cells. We noticed mutations in TetR when using XL1-blue.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9 from S. pyogenes
-
SpeciesS. pyogenes
-
Insert Size (bp)4137
-
MutationSilent mutation at bp 1341 A->C to remove an EcoRI site
- Promoter PL22
-
Tag
/ Fusion Protein
- c-myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (destroyed during cloning)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer TCAGTGATAGAGATTGACATCCCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMD19T-psba1-TetR-PL22-dCas9-SpR was a gift from Paul Hudson (Addgene plasmid # 73223 ; http://n2t.net/addgene:73223 ; RRID:Addgene_73223) -
For your References section:
Multiple Gene Repression in Cyanobacteria Using CRISPRi. Yao L, Cengic I, Anfelt J, Hudson EP. ACS Synth Biol. 2015 Dec 28. 10.1021/acssynbio.5b00264 PubMed 26689101