pMD19T-slr0230-PL22-sgRNANT1-KmR
(Plasmid
#73224)
-
PurposeContains sgRNA which targets GFPmut3b. Under an aTc inducible promoter. Suicide vector inserts into slr0230 site of Synechocystis. Carries kanamycin resistance. Propogates in E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMD19T simple
-
Backbone manufacturerTakara
- Total vector size (bp) 6094
-
Modifications to backboneHas 2 slr2030 homology regions flanking insert
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePL22-sgRNA NT1
-
gRNA/shRNA sequenceACCATCTAATTCAACAAGAATT
- Promoter PL22
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site E.coRI (not destroyed)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer GCAACGGGGTAGGGTCTATC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMD19T-slr0230-PL22-sgRNANT1-KmR was a gift from Paul Hudson (Addgene plasmid # 73224 ; http://n2t.net/addgene:73224 ; RRID:Addgene_73224) -
For your References section:
Multiple Gene Repression in Cyanobacteria Using CRISPRi. Yao L, Cengic I, Anfelt J, Hudson EP. ACS Synth Biol. 2015 Dec 28. 10.1021/acssynbio.5b00264 PubMed 26689101