-
PurposeGenome editing for gene xylR (cbei-2385) in clostridium beijerinckii NCIMB 8052
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73228 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepXY1
-
Vector typeE.coli - clostridium shuttle vector
-
Selectable markersErythromycin in clostridium
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCas9 nickase
-
SpeciesS. pyogenes MGAS5005
-
MutationD10A
- Promoter Pthl
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer SpCas9N-R TACGAGCTGTCCGTTTGAGA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA to xylR
-
SpeciesSynthetic
- Promoter Pj23119
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer unknown
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNICKclos2.0 was a gift from Sheng Yang (Addgene plasmid # 73228 ; http://n2t.net/addgene:73228 ; RRID:Addgene_73228) -
For your References section:
CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Li Q, Chen J, Minton NP, Zhang Y, Wen Z, Liu J, Yang H, Zeng Z, Ren X, Yang J, Gu Y, Jiang W, Jiang Y, Yang S. Biotechnol J. 2016 May 23. doi: 10.1002/biot.201600053. 10.1002/biot.201600053 PubMed 27213844