Skip to main content

pNICKclos2.0
(Plasmid #73228)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73228 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pXY1
  • Vector type
    E.coli - clostridium shuttle vector
  • Selectable markers
    Erythromycin in clostridium

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9 nickase
  • Species
    S. pyogenes MGAS5005
  • Mutation
    D10A
  • Promoter Pthl

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer SpCas9N-R TACGAGCTGTCCGTTTGAGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    sgRNA to xylR
  • Species
    Synthetic
  • Promoter Pj23119

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNICKclos2.0 was a gift from Sheng Yang (Addgene plasmid # 73228 ; http://n2t.net/addgene:73228 ; RRID:Addgene_73228)
  • For your References section:

    CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Li Q, Chen J, Minton NP, Zhang Y, Wen Z, Liu J, Yang H, Zeng Z, Ren X, Yang J, Gu Y, Jiang W, Jiang Y, Yang S. Biotechnol J. 2016 May 23. doi: 10.1002/biot.201600053. 10.1002/biot.201600053 PubMed 27213844