CDK12
(Plasmid
#73258)
-
PurposeBaculovirus expression for structure determination; may not be full ORF
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73258 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFB-LIC-Bse
-
Backbone manufacturerSGC, Addgene Plasmid #26108
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCDK12
-
Alt nameCRK7A-c020
-
Alt namegi|7706549
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1136
-
Mutationpfam00069: Pkinase 727-1020
-
Entrez GeneCDK12 (a.k.a. CRK7, CRKR, CRKRS)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- His-6-TEV (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer fBac-1 (tattcataccgtcccacca)
- 3′ sequencing primer fBac-2 (gggaggttttttaaagcaagtaaa) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use SF9 for protein expression. See also 4CXA: http://www.thesgc.org/structures/4CXA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CDK12 was a gift from Nicola Burgess-Brown (Addgene plasmid # 73258 ; http://n2t.net/addgene:73258 ; RRID:Addgene_73258)