Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDD317 (Pmyo-2::GFP + SEC)
(Plasmid #73344)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73344 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19 (modified)
  • Backbone size w/o insert (bp) 2600
  • Total vector size (bp) 11900
  • Modifications to backbone
    Addition of ccdB markers to facilitate homology arm cloning
  • Vector type
    Worm Expression, Cre/Lox, CRISPR
  • Selectable markers
    Hygromycin ; sqt-1(d) (worm phenotypic marker)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Turbo
  • Growth instructions
    The dual ccdB sites in this vector may make it prone to recombination. It is recommended to pick several single clones and test by restriction digestion before use. This construct should be maintained as a purified plasmid stock in addition to a bacterial stock in case there is a need to re-transform.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Pmyo-2::GFP + SEC
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    7900
  • Promoter myo-2
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
  • 3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pDD317 is a derivative of our published vectors pDD282-285 (Dickinson et al. Genetics 2015) and is intended for making gene knockouts. It has a Pmyo-2::GFP expression cassette (bright pharyngeal fluorescence) in place of the simple fluorescent protein found in our other FP–SEC vectors. Pmyo-2::GFP + SEC is intended to be inserted in place of an entire ORF such that after insertion and SEC removal, the knockout is marked with Pmyo-2::GFP. The vector also has Lox511I sites in place of LoxP, allowing pDD315 to be used in a genetic background that has already been modified using a green or red FP-SEC vector, without conflicts between Lox sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDD317 (Pmyo-2::GFP + SEC) was a gift from Bob Goldstein (Addgene plasmid # 73344 ; http://n2t.net/addgene:73344 ; RRID:Addgene_73344)
  • For your References section:

    LEA motifs promote desiccation tolerance in vivo. Hibshman JD, Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. 10.1186/s12915-021-01176-0 PubMed 34903234