pICPIS-CB
(Plasmid
#73356)
-
Purpose(Empty Backbone) AdenoX shuttle vector with chicken-beta actin CMV enhancer promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLPBL-1
-
Backbone manufacturerBaylor College of Medicine
- Backbone size (bp) 3007
-
Vector typeAdenoviral
- Promoter chicken beta-actin CMV enhancer
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CGGTGGTGGTGCAAATCAAA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byI received CB promoter from Dr. Federico Mingozzi (Genethon, France).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICPIS-CB was a gift from Kazuhiro Oka (Addgene plasmid # 73356 ; http://n2t.net/addgene:73356 ; RRID:Addgene_73356)