pVP2A-PIF6
(Plasmid
#73369)
-
PurposeExpresses Adeno-associated virus VP2 with PIF6 insert.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73369 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRepCap
- Backbone size w/o insert (bp) 7282
- Total vector size (bp) 7582
-
Modifications to backboneStart codons for VP1 and VP3 have been mutated out.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePIF6
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)300
-
Entrez GenePIL2 (a.k.a. AT3G62090, PHYTOCHROME-INTERACTING FACTOR 6, PIF6, phytochrome interacting factor 3-like 2)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EagI (unknown if destroyed)
- 3′ cloning site MluI (unknown if destroyed)
- 5′ sequencing primer gttgaggaacctgttaagatg
- 3′ sequencing primer ggagagtgctctaccggcctc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVP2A-PIF6 was a gift from Junghae Suh (Addgene plasmid # 73369 ; http://n2t.net/addgene:73369 ; RRID:Addgene_73369) -
For your References section:
Light-Activated Nuclear Translocation of Adeno-Associated Virus Nanoparticles Using Phytochrome B for Enhanced, Tunable, and Spatially Programmable Gene Delivery. Gomez EJ, Gerhardt K, Judd J, Tabor JJ, Suh J. ACS Nano. 2015 Nov 30. 10.1021/acsnano.5b05558 PubMed 26618393