Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pVP2A-PIF6
(Plasmid #73369)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73369 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRepCap
  • Backbone size w/o insert (bp) 7282
  • Total vector size (bp) 7582
  • Modifications to backbone
    Start codons for VP1 and VP3 have been mutated out.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PIF6
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    300
  • Entrez Gene
    PIL2 (a.k.a. AT3G62090, PHYTOCHROME-INTERACTING FACTOR 6, PIF6, phytochrome interacting factor 3-like 2)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EagI (unknown if destroyed)
  • 3′ cloning site MluI (unknown if destroyed)
  • 5′ sequencing primer gttgaggaacctgttaagatg
  • 3′ sequencing primer ggagagtgctctaccggcctc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVP2A-PIF6 was a gift from Junghae Suh (Addgene plasmid # 73369 ; http://n2t.net/addgene:73369 ; RRID:Addgene_73369)
  • For your References section:

    Light-Activated Nuclear Translocation of Adeno-Associated Virus Nanoparticles Using Phytochrome B for Enhanced, Tunable, and Spatially Programmable Gene Delivery. Gomez EJ, Gerhardt K, Judd J, Tabor JJ, Suh J. ACS Nano. 2015 Nov 30. 10.1021/acsnano.5b05558 PubMed 26618393