Skip to main content
Addgene

pAAVS1-NC-CRISPRi (Gen3)
(Plasmid #73499)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73499 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAVS1
  • Backbone size w/o insert (bp) 3356
  • Total vector size (bp) 11437
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-KRAB
  • Species
    Synthetic; S. pyogenes
  • Insert Size (bp)
    4490
  • Mutation
    D10A, H840A (catalytically deactivated Cas9)
  • Promoter CAG
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • NLS (C terminal on insert)
    • KRAB (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CCTCTGCTAACCATGTTCATGC
  • 3′ sequencing primer TTCTGATAGGCAGCCTGCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    dCas9-KRAB fusion transgene was a a gift from Stanley Qi
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAVS1-NC-CRISPRi (Gen3) was a gift from Bruce Conklin (Addgene plasmid # 73499 ; http://n2t.net/addgene:73499 ; RRID:Addgene_73499)
  • For your References section:

    CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs. Mandegar MA, Huebsch N, Frolov EB, Shin E, Truong A, Olvera MP, Chan AH, Miyaoka Y, Holmes K, Spencer CI, Judge LM, Gordon DE, Eskildsen TV, Villalta JE, Horlbeck MA, Gilbert LA, Krogan NJ, Sheikh SP, Weissman JS, Qi LS, So PL, Conklin BR. Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi: 10.1016/j.stem.2016.01.022. Epub 2016 Mar 10. 10.1016/j.stem.2016.01.022 PubMed 26971820