Skip to main content

pgRNA-CKB
(Plasmid #73501)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73501 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSico
  • Total vector size (bp) 9596
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mKate2-T2A-Bsd
  • gRNA/shRNA sequence
    Scramble gRNA sequence with BsmBI cloning sites
  • Species
    H. sapiens (human), Synthetic
  • Promoter CAG
  • Tag / Fusion Protein
    • NLS (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCTCTGCTAACCATGTTCATGC
  • 3′ sequencing primer GATCTACCACATTTGTAGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Due to the large size of this gRNA expression vector it does not produce high-tire lentivirus. Hence we do not recommend using this plasmid backbone for lentivral preparation. This gRNA-expression plasmid is best suited for plasmid transfections and generation of stable clones.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pgRNA-CKB was a gift from Bruce Conklin (Addgene plasmid # 73501 ; http://n2t.net/addgene:73501 ; RRID:Addgene_73501)
  • For your References section:

    CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs. Mandegar MA, Huebsch N, Frolov EB, Shin E, Truong A, Olvera MP, Chan AH, Miyaoka Y, Holmes K, Spencer CI, Judge LM, Gordon DE, Eskildsen TV, Villalta JE, Horlbeck MA, Gilbert LA, Krogan NJ, Sheikh SP, Weissman JS, Qi LS, So PL, Conklin BR. Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi: 10.1016/j.stem.2016.01.022. Epub 2016 Mar 10. 10.1016/j.stem.2016.01.022 PubMed 26971820