pMIG-hNFATc1/bC - AVITEV
(Plasmid
#74059)
-
Purposeretroviral expression plasmid for human NFATc1/bC with C-terminal BirA-biotinylation signal and TEV celavage site
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74059 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV-IRES-GFP (pMIG)
- Backbone size w/o insert (bp) 7200
- Total vector size (bp) 9956
-
Modifications to backboneadded SV40-Ori
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman NFATc1, isoform beta-C
-
Alt nameNFAT2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2900
-
GenBank IDNM_172387 ID: 4772
-
Entrez GeneNFATC1 (a.k.a. NF-ATC, NF-ATc1.2, NFAT2, NFATc)
- Promoter pMSCV-LTRs
-
Tag
/ Fusion Protein
- AVI-TEV (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site swaI (not destroyed)
- 3′ cloning site SnaB1, Sgf1 (not destroyed)
- 5′ sequencing primer CGTTCGACCCCGCCTCGATCC
- 3′ sequencing primer AGCTTGATATCGAATTCCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bysequence synthesis by company
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Avi-Tev-Tag is biotinylated by BirA E.coli biotin ligase when coexpressed, and can be cleaved by TEV protease.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMIG-hNFATc1/bC - AVITEV was a gift from Ria Baumgrass (Addgene plasmid # 74059 ; http://n2t.net/addgene:74059 ; RRID:Addgene_74059) -
For your References section:
Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333