This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #74059)


Item Catalog # Description Quantity Price (USD)
Plasmid 74059 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7200
  • Total vector size (bp) 9956
  • Modifications to backbone
    added SV40-Ori
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    human NFATc1, isoform beta-C
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
    NM_172387 ID: 4772
  • Entrez Gene
    NFATC1 (a.k.a. NF-ATC, NF-ATc1.2, NFAT2, NFATc)
  • Promoter pMSCV-LTRs
  • Tag / Fusion Protein
    • AVI-TEV (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site swaI (not destroyed)
  • 3′ cloning site SnaB1, Sgf1 (not destroyed)
  • 5′ sequencing primer CGTTCGACCCCGCCTCGATCC
  • 3′ sequencing primer AGCTTGATATCGAATTCCG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The Avi-Tev-Tag is biotinylated by BirA E.coli biotin ligase when coexpressed, and can be cleaved by TEV protease.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMIG-hNFATc1/bC - AVITEV was a gift from Ria Baumgrass (Addgene plasmid # 74059 ; ; RRID:Addgene_74059)
  • For your References section:

    Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333