pRIM3-rfp
              
              
                (Plasmid
                
                #74073)
              
            
            
            
          - 
            PurposeGentR version of pRIM2 carrying rfp
 - 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74073 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepRIM2
 - 
              Modifications to backboneGentR added
 - 
              Vector typeBacterial Expression, CRISPR, Synthetic Biology
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Gentamicin, 10 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert namerfp
 - Promoter ptac
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer CGACATCATAACGGTTCTGGC (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pRIM3-rfp was a gift from Timothy Lu (Addgene plasmid # 74073 ; http://n2t.net/addgene:74073 ; RRID:Addgene_74073) - 
                
For your References section:
Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). Cleto S, Jensen JV, Wendisch VF, Lu TK. ACS Synth Biol. 2016 Feb 16. 10.1021/acssynbio.5b00216 PubMed 26829286