gWizPlum
(Plasmid
#74475)
-
PurposeExpression of Plum fluorescent protein in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74475 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonegWiz-blank
-
Backbone manufacturerAldevron
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 5800
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemPlum fluorescent protein
-
Insert Size (bp)718
- Promoter CMV+intron
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer pMRB101-F - aagatgcaggcagctgagtt
- 3′ sequencing primer pXCX-F - ACAACAGATGGCTGGCAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byA portion of this plasmid was derived from the pmPlum Vector, C/N 632537, Clontech.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plum is a far red fluorescent protein.
Excitation 590 nm
Emission 649 nm
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gWizPlum was a gift from Loree Heller (Addgene plasmid # 74475 ; http://n2t.net/addgene:74475 ; RRID:Addgene_74475)