Skip to main content

gWizPlum
(Plasmid #74475)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74475 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 74475-D50 50 μg of DNA in Tris buffer $495
DNA 74475-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    gWiz-blank
  • Backbone manufacturer
    Aldevron
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 5800
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mPlum fluorescent protein
  • Insert Size (bp)
    718
  • Promoter CMV+intron

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer pMRB101-F - aagatgcaggcagctgagtt
  • 3′ sequencing primer pXCX-F - ACAACAGATGGCTGGCAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    A portion of this plasmid was derived from the pmPlum Vector, C/N 632537, Clontech.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plum is a far red fluorescent protein.
Excitation 590 nm
Emission 649 nm

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gWizPlum was a gift from Loree Heller (Addgene plasmid # 74475 ; http://n2t.net/addgene:74475 ; RRID:Addgene_74475)