-
PurposeLight-activated Cdc42
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75263 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTriEx
- Backbone size w/o insert (bp) 5040
- Total vector size (bp) 6747
-
Vector typeMammalian Expression, Bacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCell Division Cycle 42
-
SpeciesH. sapiens (human)
-
Insert Size (bp)564
-
MutationF56W
-
GenBank IDNM_001039802.1
-
Entrez GeneCDC42 (a.k.a. CDC42Hs, G25K, TKS)
- Promoter CMV
-
Tags
/ Fusion Proteins
- 6xHIs (N terminal on insert)
- mVenus (N terminal on insert)
- LOV2 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer aagtatcgggccctttgtgc
- 3′ sequencing primer GGCAGCCTGCACCTGAGGTTAATCAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PA-Cdc42 was a gift from Klaus Hahn (Addgene plasmid # 75263 ; http://n2t.net/addgene:75263 ; RRID:Addgene_75263) -
For your References section:
A genetically encoded photoactivatable Rac controls the motility of living cells. Wu YI, Frey D, Lungu OI, Jaehrig A, Schlichting I, Kuhlman B, Hahn KM. Nature. 2009 Sep 3. 461(7260):104-8. 10.1038/nature08241 PubMed 19693014