Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PA-Cdc42
(Plasmid #75263)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 75263 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTriEx
  • Backbone size w/o insert (bp) 5040
  • Total vector size (bp) 6747
  • Vector type
    Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cell Division Cycle 42
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    564
  • Mutation
    F56W
  • GenBank ID
    NM_001039802.1
  • Entrez Gene
    CDC42 (a.k.a. CDC42Hs, G25K, TKS)
  • Promoter CMV
  • Tags / Fusion Proteins
    • 6xHIs (N terminal on insert)
    • mVenus (N terminal on insert)
    • LOV2 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer aagtatcgggccctttgtgc
  • 3′ sequencing primer GGCAGCCTGCACCTGAGGTTAATCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PA-Cdc42 was a gift from Klaus Hahn (Addgene plasmid # 75263 ; http://n2t.net/addgene:75263 ; RRID:Addgene_75263)
  • For your References section:

    A genetically encoded photoactivatable Rac controls the motility of living cells. Wu YI, Frey D, Lungu OI, Jaehrig A, Schlichting I, Kuhlman B, Hahn KM. Nature. 2009 Sep 3. 461(7260):104-8. 10.1038/nature08241 PubMed 19693014