-
PurposeExpresses alpha-amanitin resistant EYFP tagged POLR2A in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75284 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEYFP-C1
-
Backbone manufacturerBD Biosciences Clontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 10646
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePOLR2A
-
Alt nameRPB1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5911
-
MutationN792D alpha-amanitin–resistant
-
GenBank IDNM_000937.4
-
Entrez GenePOLR2A (a.k.a. NEDHIB, POLR2, POLRA, RPB1, RPBh1, RPO2, RPOL2, RpIILS, hRPB220, hsRPB1)
- Promoter CMV
-
Tag
/ Fusion Protein
- EYFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CMV Forward CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer pX-C1 REVseq TATGTTTCAGGTTCAGGGGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYFP-RPB1aAmr was a gift from Xavier Darzacq & Robert Singer (Addgene plasmid # 75284 ; http://n2t.net/addgene:75284 ; RRID:Addgene_75284) -
For your References section:
In vivo dynamics of RNA polymerase II transcription. Darzacq X, Shav-Tal Y, de Turris V, Brody Y, Shenoy SM, Phair RD, Singer RH. Nat Struct Mol Biol. 2007 Sep;14(9):796-806. Epub 2007 Aug 5. 10.1038/nsmb1280 PubMed 17676063