-
Purposedoxycycline inducible Notch1 intracellular domain gene over-expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneN/A
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNotch1 Intracellular domain
-
Alt nameNotch1IC
-
SpeciesM. musculus (mouse)
-
Entrez GeneNotch1 (a.k.a. 9930111A19Rik, Mis6, N1, Tan1, lin-12)
- Promoter TRE-tight
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cagctcaggttctgggagag
- 3′ sequencing primer gaaatttgtgatgctattgc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene: 15079
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Puro-iNotch1IC was a gift from Danwei Huangfu (Addgene plasmid # 75338 ; http://n2t.net/addgene:75338 ; RRID:Addgene_75338) -
For your References section:
Genome Editing of Lineage Determinants in Human Pluripotent Stem Cells Reveals Mechanisms of Pancreatic Development and Diabetes. Zhu Z, Li QV, Lee K, Rosen BP, Gonzalez F, Soh CL, Huangfu D. Cell Stem Cell. 2016 Apr 27. pii: S1934-5909(16)30002-9. doi: 10.1016/j.stem.2016.03.015. 10.1016/j.stem.2016.03.015 PubMed 27133796