Skip to main content

pZE27GFP3E
(Plasmid #75463)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75463 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pZE21
  • Modifications to backbone
    replace pLtetO promoter with placIq promoter
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gfp-pdt#3E
  • Species
    E. coli
  • Promoter placIq promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TGGTGCAAAACCTTTCGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZE27GFP3E was a gift from James Collins (Addgene plasmid # 75463 ; http://n2t.net/addgene:75463 ; RRID:Addgene_75463)
  • For your References section:

    Tunable protein degradation in bacteria. Cameron DE, Collins JJ. Nat Biotechnol. 2014 Dec;32(12):1276-81. doi: 10.1038/nbt.3053. Epub 2014 Nov 17. 10.1038/nbt.3053 PubMed 25402616