-
PurposeNuclear fluorescent reporter in mammalian cells, phiC31 attB for integration, can be silenced with TetR-CR or rTetR-CR (e.g. CR can be KRAB or DNMT3B).
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78099 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSLR-test
-
Backbone manufacturerToyobo, Osaka, Japan
- Backbone size w/o insert (bp) 9432
- Total vector size (bp) 12550
-
Modifications to backbonereplaced the SLR gene with Neo (blunt-end ligation after digesting pSLR-test with EcoRV/SmaI, see PLoS One 6.2 (2011): e17267) introduced MCS with 2 cHS4 insulators on each side
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHistone H2B - Citrine
-
Alt namehistone cluster 2, H2be
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)3080
-
GenBank IDhttps://www.ncbi.nlm.nih.gov/gene/8349
-
Entrez GeneH2BC21 (a.k.a. GL105, H2B, H2B-GL105, H2B.1, H2BE, H2BFQ, H2BGL105, H2BQ, HIST2H2BE)
- Promoter 5xTetO pEF alpha
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCIF_3 GAAGACGTCGATATACGCGT
- 3′ sequencing primer TCIR_5 GGAGCTCCACCCTAGAACTA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPhiC31-Neo-ins-MCS-ins was a gift from Mitsuo Oshimura. pCS-H2B-citrine was a gift from Sean Megasson.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Can be used for constitutive expression of H2B-citrine.
Can be silenced by TetR-KRAB or rTetR-KRAB (using doxycycline).
It can be site-specifically integrated in a PhiC31 attP site (the plasmid contains a PhiC31 attB site).
The reporter gene is flanked by two full length (1.2kb each) chicken HS4 insulators on each side.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PhiC31-Neo-ins-5xTetO-pEF-H2B-Citrine-ins was a gift from Michael Elowitz (Addgene plasmid # 78099 ; http://n2t.net/addgene:78099 ; RRID:Addgene_78099) -
For your References section:
Dynamics of epigenetic regulation at the single-cell level. Bintu L, Yong J, Antebi YE, McCue K, Kazuki Y, Uno N, Oshimura M, Elowitz MB. Science. 2016 Feb 12;351(6274):720-4. doi: 10.1126/science.aab2956. 10.1126/science.aab2956 PubMed 26912859
Map uploaded by the depositor.