Skip to main content
Addgene

sgTP53_3
(Plasmid #78164)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78164 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiGuide-Puro
  • Backbone manufacturer
    Addgene plasmid 52963
  • Backbone size w/o insert (bp) 10183
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TP53
  • gRNA/shRNA sequence
    CACCGCCCCTTGCCGTCCCAAGCAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
  • Promoter hU6

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The RNAi Consortium / Broad Institute
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgTP53_3 was a gift from William Hahn (Addgene plasmid # 78164 ; http://n2t.net/addgene:78164 ; RRID:Addgene_78164)
  • For your References section:

    Integrated genetic and pharmacologic interrogation of rare cancers. Hong AL, Tseng YY, Cowley GS, Jonas O, Cheah JH, Kynnap BD, Doshi MB, Oh C, Meyer SC, Church AJ, Gill S, Bielski CM, Keskula P, Imamovic A, Howell S, Kryukov GV, Clemons PA, Tsherniak A, Vazquez F, Crompton BD, Shamji AF, Rodriguez-Galindo C, Janeway KA, Roberts CW, Stegmaier K, van Hummelen P, Cima MJ, Langer RS, Garraway LA, Schreiber SL, Root DE, Hahn WC, Boehm JS. Nat Commun. 2016 Jun 22;7:11987. doi: 10.1038/ncomms11987. 10.1038/ncomms11987 PubMed 27329820