Skip to main content

TetO-dCas9-D3A
(Plasmid #78254)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78254 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Addgene # 20321
  • Total vector size (bp) 14829
  • Modifications to backbone
    We took out OSKM and put in new MCS site: EcoRI-XbaI-NheI-AgeI-PspXI-AscI-EcoRI
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DNMT3A CD aa 598-912
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    948
  • GenBank ID
    AF480163
  • Entrez Gene
    DNMT3A (a.k.a. DNMT3A2, HESJAS, M.HsaIIIA, TBRS)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag epitope tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer ctgcagccttcaagtacttcgacacc
  • 3′ sequencing primer ATGCTCGTCAAGAAGACAGGGCCAGGTTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The dCas9 insert in this plasmid also contains a T1167A mutation, which is unlikely to affect the function of the plasmid, as it is already a catalytically dead Cas9 mutant.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TetO-dCas9-D3A was a gift from Grant Challen (Addgene plasmid # 78254 ; http://n2t.net/addgene:78254 ; RRID:Addgene_78254)
  • For your References section:

    Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. McDonald JI, Celik H, Rois LE, Fishberger G, Fowler T, Rees R, Kramer A, Martens A, Edwards JR, Challen GA. Biol Open. 2016 May 11. pii: bio.019067. doi: 10.1242/bio.019067. 10.1242/bio.019067 PubMed 27170255