pKH-MoHyPer
(Plasmid
#78267)
-
PurposeExpress HyPer-AS sensor that change excitation wavelength with the presence of hydrogen peroxide.
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78267 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCb1531
- Backbone size w/o insert (bp) 4339
- Total vector size (bp) 5789
-
Vector typeYeast Expression ; Express in Magnaporthe
-
Selectable markersBaialaphos
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMoHyper
-
SpeciesS. cerevisiae (budding yeast), S. pombe (fission yeast); Magnaporthe
-
Insert Size (bp)1450
- Promoter Rp27
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BstEII (not destroyed)
- 5′ sequencing primer ACCATGGAAATGGCCTCTCA
- 3′ sequencing primer TCAAACGGCCTGCTTAAGGACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKH-MoHyPer was a gift from Jeffrey Caplan & Nicole Donofrio (Addgene plasmid # 78267 ; http://n2t.net/addgene:78267 ; RRID:Addgene_78267) -
For your References section:
Optimization of the HyPer sensor for robust real-time detection of hydrogen peroxide in the rice blast fungus. Huang K, Caplan J, Sweigard J, Czymmek K, Donofrio N. Mol Plant Pathol. 2016 Mar 7. doi: 10.1111/mpp.12392. 10.1111/mpp.12392 PubMed 26950262