pDECKO-mCherry MALAT1_Exon.4
(Plasmid
#78543)
-
PurposeExperimental plasmid
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDECKO_mCherry
- Total vector size (bp) 9430
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA1+scaffold+H1promoter+gRNA2
-
gRNA/shRNA sequence2 guide RNAs against MALAT1_Exon.4
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTACAAAATACGTGACGTAG
- 3′ sequencing primer ATGTCTACTATTCTTTCCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Experimental plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDECKO-mCherry MALAT1_Exon.4 was a gift from Roderic Guigo & Rory Johnson (Addgene plasmid # 78543 ; http://n2t.net/addgene:78543 ; RRID:Addgene_78543) -
For your References section:
Scalable Design of Paired CRISPR Guide RNAs for Genomic Deletion. Pulido-Quetglas C, Aparicio-Prat E, Arnan C, Polidori T, Hermoso T, Palumbo E, Ponomarenko J, Guigo R, Johnson R. PLoS Comput Biol. 2017 Mar 2;13(3):e1005341. doi: 10.1371/journal.pcbi.1005341. eCollection 2017 Mar. PCOMPBIOL-D-16-01254 [pii] PubMed 28253259