pZac2.1 U6-SaAi9L-U6-SaAi9R
(Plasmid
#78604)
-
PurposeAAV vector containing gRNAs (for SaCas9) targeting Ai9 stop cassette
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78604 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepZac2.1
- Total vector size (bp) 4214
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNAs for SaCas9 targeting Ai9 locus
-
gRNA/shRNA sequenceCTCTAGAGTCGCAGATCCTC; ACGAAGTTATATTAAGGGTT
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SnaBI (destroyed during cloning)
- 3′ cloning site SnaBI (destroyed during cloning)
- 5′ sequencing primer TGTGCTGGAATTCGCCCTTA
- 3′ sequencing primer CCTCTAGATGCATGCTCGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZac2.1 U6-SaAi9L-U6-SaAi9R was a gift from Amy Wagers (Addgene plasmid # 78604 ; http://n2t.net/addgene:78604 ; RRID:Addgene_78604) -
For your References section:
In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Tabebordbar M, Zhu K, Cheng JK, Chew WL, Widrick JJ, Yan WX, Maesner C, Wu EY, Xiao R, Ran FA, Cong L, Zhang F, Vandenberghe LH, Church GM, Wagers AJ. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31. 10.1126/science.aad5177 PubMed 26721686
Map uploaded by the depositor.