This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTol2-DRv6
(Plasmid #78628)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 78628 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GESTALT lineage tracing target V6
  • Alt name
    V6
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    324

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAATTCTCGACCTCGAGACAAATGGCAG
  • 3′ sequencing primer AAGCTTGAGCTCGAGATCTGAGTCCGGA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

GESTALT V6 barcode for integration into zebrafish using the Tol2 system

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol2-DRv6 was a gift from Jay Shendure (Addgene plasmid # 78628)
  • For your References section:

    Whole organism lineage tracing by combinatorial and cumulative genome editing. McKenna A, Findlay GM, Gagnon JA, Horwitz MS, Schier AF, Shendure J. Science. 2016 May 26. pii: aaf7907. 10.1126/science.aaf7907 PubMed 27229144