pLJM1-EGFP-BarcodeV4
(Plasmid
#78630)
-
PurposeGESTALT V4 integrating barcode with Puro and EGFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78630 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLJM1-EGFP
-
Backbone manufacturerhttps://www.addgene.org/19319/
- Backbone size w/o insert (bp) 8083
- Total vector size (bp) 8365
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGESTALT lineage tracing target V4
-
Alt nameV4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)280
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGAATTCTCGACCTCGAGACA
- 3′ sequencing primer CGAAGCTTGAGCTCGAGATCTGAGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhttps://www.addgene.org/19319/
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene 19319 - pLJM1-EGFP, with GESTALT V4 barcode insert at the 3' terminus of EGFP
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM1-EGFP-BarcodeV4 was a gift from Jay Shendure (Addgene plasmid # 78630 ; http://n2t.net/addgene:78630 ; RRID:Addgene_78630) -
For your References section:
Whole organism lineage tracing by combinatorial and cumulative genome editing. McKenna A, Findlay GM, Gagnon JA, Horwitz MS, Schier AF, Shendure J. Science. 2016 May 26. pii: aaf7907. 10.1126/science.aaf7907 PubMed 27229144