pAct:dCas9-VP64
(Plasmid
#78901)
-
PurposeExpresses dCas9-VP64 under actin promoter for SAM CRISPRa in Drosophila cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78901 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAWG
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-VP64
-
Insert Size (bp)4875
- Promoter pActin (Drosophila)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTGAACGCGACTTGAGAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bydCas9:VP64 cloned from Addgene 61425 into vector for Actin-driven expression in Drosophila cells
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAct:dCas9-VP64 was a gift from Norbert Perrimon (Addgene plasmid # 78901 ; http://n2t.net/addgene:78901 ; RRID:Addgene_78901) -
For your References section:
Comparison of Cas9 activators in multiple species. Chavez A, Tuttle M, Pruitt BW, Ewen-Campen B, Chari R, Ter-Ovanesyan D, Haque SJ, Cecchi RJ, Kowal EJ, Buchthal J, Housden BE, Perrimon N, Collins JJ, Church G. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. 10.1038/nmeth.3871 PubMed 27214048