Skip to main content

Cas9-GFP_sg_mTfeb
(Plasmid #79006)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79006 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-GFP (PX458)
  • Total vector size (bp) 9300
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgTfeb
  • gRNA/shRNA sequence
    AGCACTGTTGCCGGCCGAGG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Tfeb (a.k.a. Tcfeb, bHLHe35)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cas9-GFP_sg_mTfeb was a gift from Reuben Shaw (Addgene plasmid # 79006 ; http://n2t.net/addgene:79006 ; RRID:Addgene_79006)
  • For your References section:

    AMPK governs lineage specification through Tfeb-dependent regulation of lysosomes. Young NP, Kamireddy A, Van Nostrand JL, Eichner LJ, Shokhirev MN, Dayn Y, Shaw RJ. Genes Dev. 2016 Mar 1;30(5):535-52. doi: 10.1101/gad.274142.115. 10.1101/gad.274142.115 PubMed 26944679