-
PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse Tfeb.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSpCas9(BB)-2A-GFP (PX458)
- Total vector size (bp) 9300
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgTfeb
-
gRNA/shRNA sequenceAGCACTGTTGCCGGCCGAGG
-
SpeciesM. musculus (mouse)
-
Entrez GeneTfeb (a.k.a. Tcfeb, bHLHe35)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cas9-GFP_sg_mTfeb was a gift from Reuben Shaw (Addgene plasmid # 79006 ; http://n2t.net/addgene:79006 ; RRID:Addgene_79006) -
For your References section:
AMPK governs lineage specification through Tfeb-dependent regulation of lysosomes. Young NP, Kamireddy A, Van Nostrand JL, Eichner LJ, Shokhirev MN, Dayn Y, Shaw RJ. Genes Dev. 2016 Mar 1;30(5):535-52. doi: 10.1101/gad.274142.115. 10.1101/gad.274142.115 PubMed 26944679