pCAGGS-Trex2
(Plasmid #79246)

• Purpose: Expression vector for Trex2, which is a non-processive 3' exonuclease.
• Depositing Lab: Jeremy Stark
• Publication: Bennardo et al PLoS Genet. 2009 Oct;5(10):e1000683. doi: 10.1371/journal.pgen.1000683. Epub 2009 Oct 16.

Backbone

• Vector backbone: pCAGGS
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Trex2
• Species: M. musculus (mouse)
• GenBank ID: NM_011907
• Entrez Gene: Trex2
• Promoter: pCAGGS

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ttcctacagctcctgggcaacg
• 3′ sequencing primer: ttttggcagagggaaaaaga

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Expression vector for Trex2, which is a non-processive 3' exonuclease. Including co-expression of Trex2 with nucleases that induce site-specific chromosomal double strand breaks can cause elevated mutagenesis of the target site.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry