PGL3-Ogt (-178 to +233 bp)
(Plasmid
#79266)
-
PurposeTo identify the Cis and Trans acting elements that control Ogt gene transcription.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79266 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePGL3-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOgt promoter element
-
Alt nameOgt gene fragment -178 to +233 bp
-
SpeciesM. musculus (mouse)
-
Entrez GeneOgt (a.k.a. 1110038P24Rik, 4831420N21Rik, AI115525, OG, Ogtl)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GAGCCCTTAACCCGGAGTT
- 3′ sequencing primer GGAGCTTCTTGAGATAGAAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGL3-Ogt (-178 to +233 bp) was a gift from Steven Jones (Addgene plasmid # 79266 ; http://n2t.net/addgene:79266 ; RRID:Addgene_79266) -
For your References section:
E2F1 Transcription Factor Regulates O-linked N-acetylglucosamine (O-GlcNAc) Transferase and O-GlcNAcase Expression. Muthusamy S, Hong KU, Dassanayaka S, Hamid T, Jones SP. J Biol Chem. 2015 Dec 25;290(52):31013-24. doi: 10.1074/jbc.M115.677534. Epub 2015 Nov 2. 10.1074/jbc.M115.677534 PubMed 26527687