Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pVQ CMV NanoV1Mutant-2a-EGFP ferritin
(Plasmid #79650)


Item Catalog # Description Quantity Price (USD)
Plasmid 79650 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6217
  • Total vector size (bp) 11351
  • Modifications to backbone
  • Vector type
    Mammalian Expression, Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number

Gene/Insert 1

  • Gene/Insert name
    transient receptor potential vanilloid 1
  • Alt name
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
  • Mutation
    isoleucine 679 changed to lysine
  • Entrez Gene
    Trpv1 (a.k.a. TRPV1_SON, VR.5'sv, Vr1, Vr1l1)
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (not destroyed)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer ggtctatataagcagagctg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    camelid anti-GFP nanobody
  • Species
  • Insert Size (bp)
  • Promoter CMV

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    Enhanced green fluorescent protein
  • Alt name
  • Insert Size (bp)
  • Promoter CMV

Cloning Information for Gene/Insert 3

Gene/Insert 4

  • Gene/Insert name
    mouse ferritin light chain
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Entrez Gene
    Ftl1 (a.k.a. Ftl, Ftl-1, L-ferritin)
  • Promoter CMV

Cloning Information for Gene/Insert 4

Gene/Insert 5

  • Gene/Insert name
    mouse ferritin heavy chain
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Fth1 (a.k.a. FHC, Fth, HFt, MFH)
  • Promoter CMV

Cloning Information for Gene/Insert 5

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVQ CMV NanoV1Mutant-2a-EGFP ferritin was a gift from Jeffrey Friedman (Addgene plasmid # 79650 ; ; RRID:Addgene_79650)
  • For your References section:

    Bidirectional electromagnetic control of the hypothalamus regulates feeding and metabolism. Stanley SA, Kelly L, Latcha KN, Schmidt SF, Yu X, Nectow AR, Sauer J, Dyke JP, Dordick JS, Friedman JM. Nature. 2016 Mar 31;531(7596):647-50. doi: 10.1038/nature17183. Epub 2016 Mar 23. 10.1038/nature17183 PubMed 27007848